Link to NIFA Home Page Link to USDA Home Page
Current Research Information System Link to CRIS Home Page

Item No. 1 of 1

ACCESSION NO: 1012220 SUBFILE: CRIS
PROJ NO: ARX02016-06509 AGENCY: NIFA AR.X
PROJ TYPE: OTHER GRANTS PROJ STATUS: EXTENDED
CONTRACT/GRANT/AGREEMENT NO: 2017-38821-26412 PROPOSAL NO: 2016-06509
START: 15 MAY 2017 TERM: 14 MAY 2021 FY: 2019
GRANT AMT: $497,479 GRANT YR: 2017
AWARD TOTAL: $497,479
INITIAL AWARD YEAR: 2017

INVESTIGATOR: Ponniah, S.

PERFORMING INSTITUTION:
UNIV OF ARKANSAS
PINE BLUFF, ARKANSAS 71601

GENE EDITING IN RICE GENOME TOWARDS DEVELOPING IMPROVED RICE VARIETIES

NON-TECHNICAL SUMMARY: Chalkiness in rice is a highly undesirable trait as it contributes to milling loss due to grain breakage, in addition to negatively impacting grain appearance, cooking quality, and palatability. The presence of chalk in the milled rice lowers the value of the rice in most domestic and international markets. Reducing the chalk, therefore, would benefit farmers, millers, traders and consumers, by increasing the yield of marketable rice, thereby contributing to food security and potential income. The overall goal of this project is to carry out gene editing in Chalk5, a major genetic determinant of grain chalkiness, in elite Arkansas rice varieties. The immediate objective of this proposal is to delete cis-elements, associated with the elevated Chalk5 expression in early grain filling stages, using CRISPR/Cas9 mediated targeted mutagenesis. The project will lead to: 1) reduced chalkiness in rice, 2) improved rice yield, 3) trained undergraduate/ graduate minority students in biotechnology, 4) establishment of collaboration between UAPB and University of Arkansas, and 4) strengthened research and teaching capacity of UAPB.

OBJECTIVES: Grain quality dictates value of rice in the market, and impacts the yield of the processed 'white' rice (also known as 'head rice yield'). The translucent full-length (head) rice commands higher value in the market compared to 'chalky' rice. Chalk is the opaque area in rice endosperm that reduces overall yield by increasing the fraction of broken rice and/or opaque grains. Chalkiness is a complex trait manifested by small, loosely packed starch granules and increased amount of long chain amylopectin (Lisle et al., 2000; Wang et al., 2013). The natural variation in chalkiness has long been documented, but its genetic basis has been masked by the complex source-sink interaction (Fitzgerald et al. 2009). Chalk content is negatively correlated with head rice yield. With every incremental increase in grain chalk content, there is a concomitant decrease in head rice yield (Lyman et al., 2013; Zhao and Fitzgerald, 2013). Chalkiness is found to be elevated in the rice grown in warmer seasons, therefore, unless chalk is reduced in the high yielding rice varieties, a significant food security issue remains unsolved in the years ahead when earth atmosphere is projected to become warmer (Fitzgerald et al., 2009). Significant efforts in determining chalk QTLs have been made in the recent time as rice biologists recognize the relation of chalky trait with food security (Zhao et al., 2016). However, breeding for low chalk has been very difficult due to the genetic distance from low chalk varieties, instability in multiple environments, and the association of high chalk with yield QTLs.Many studies have explored the correlation of starch biosynthesis genes with grain quality including chalk content. Starch biosynthesis is regulated by complex pathway involving multiple genes. The lossof function mutants in starch biosynthesis genes show drastically reduced starch content and rice yield. Polymorphism discovery efforts in 18 starch biosynthesis genes in 233 Australian rice breeding lines found very limited variation--no polymorphism or significant association with the quality traits in 12 of 18 starch related genes Therefore, breeding for quality traits would require new alleles either by introducing new germplasm or by creating these alleles in the breeding lines by gene editing. Manychalk QTLs have been described. Recently, Chalk5 as amajor genetic determinant of grain chalkiness has been identified. This indica Chalk5 allele, associated with high chalkiness, is tightlylinked to two yield QTLs explaining the linkage of high yield and high chalkiness in indica varieties. Chalk5 QTL has also been reported in more than one population: H94 (low chalk indica) x Z97 (high chalk indica) and LMT (low chalk japonica) x TQ (high chalk indica). Discovery of Chalk5 in different environments and populations derived from indica and japonica indicates its importance in diverse lines and stability in multiple environments. The goal of this proposal is to reduce chalkiness through Chalk5 gene editing in the elite rice varieties by deleting cis-elements, associated with the elevated Chalk5 expression in early grain filling stages, using CRISPR/Cas9 mediated targeted mutagenesis approach.

APPROACH: Objective 1: Determine structure and function of Chalk5 gene in the selected rice cultivars by resequencing Chalk5 locus.The chalky phenotype of most Arkansas rice varieties is available through Arkansas variety testing program (http://arkansasagnews.uark.edu/1356.htm). We will sequence complete Chalk5 gene in 23 rice varieties that were selected based on their importance in Arkansas rice breeding program. We will use the overlapping primers of the 6.2 kb locus (Chromosome 5: 3319645 to 3313450; Os05g0156900) for PCR and amplicon sequencing. 'CL151' and 'Nipponbare' will be included as controls. CL151 is a hybrid rice variety found as the leading chalk-susceptible variety in Arkansas. These sequences will be aligned using ClustalW program to identify polymorphisms in the sequences, and search for their correlation with the published chalk data (phenotype): (a) head rice yield, (b) amylopectin long chain content, (c) white belly and white core appearance.Objective 2: Determine the role of Chalk5 in temperature-induced chalk formation by quantitative gene expression in grains obtained from plants growing in the elevated night time temperature.a. Chalk phenotyping: As a parameter of chalkiness and its correlation with Chalk5, we will examine the chalk formation due to high nighttime temperature (HNT) in the selected rice varieties. For this, we will grow the plants (2 plants in a 5-gallon pot) in the greenhouse in optimum conditions until anthesis or R4 stage. At R4 stage, 2 pots of each variety will be transferred to two identical walk-in Conviron growth chambers (control and HNT) for the duration of grain filling until R6. The day temperature in the two chambers will be same i.e. 25oC in the morning (6:00 - 12:00), 27oC in afternoon (12:00 - 16:00), and 25oC in the evening (16:00 - 21:00). The night temperature (21:00 - 6:00) in the control chamber will be 18oC and in the hot chamber 30oC. Chalk will be observed in white light and quantified by Winseedle Pro 2005a (Regent Instruments Inc.) that images opaque area in seeds through a transilluminator. This data along with the published data on grain chalkiness of Arkansas elite rice varieties (http://arkansasagnews.uark.edu/1356.htm) will be used for the correlation of phenotype with Chalk5 polymorphism.b. Chalk5 expression analysis: To understand the role of Chalk5 in chalkiness reported in the Arkansas rice varieties, we will determine its expression pattern in the endosperm of the developing seeds. Cypress (low chalk), CL151 (high chalk) and Nipponbare (low quality) will be used as controls. From the plants above (chalk phenotyping experiment) consisting of 2 plants of each variety, immature seeds (milky to soft dough stage), 5 and 10 days after fertilization (d.a.f.), will be collected from the control and HNT samples. Total RNA, isolated by RNeasy kit, will be used for qRT-PCR with primers described by Li et al. (2014) for Chalk5 cDNA (NCBI accession no. KJ363317). The general design of experiment consists of 2 plants of each variety to collect 3 samples each for qRT-PCR in 2 replicates (2 x 3 x 2). The total number of samples will be based on phenotyping data as we will choose to a smaller set of 'most chalky' and 'least chalky' varieties.Objective 3: Perform gene editing of Chalk5 in the selected rice cultivars by CRISPR-Cas9 method. Develop transgenic lines, characterize knockout alleles, survey off-target effects, and correlate knockouts with gene expression and plant phenotype.a. Arkansas rice varieties for trait modification by CRISPR technology: In addition to 'Nipponbare', we propose to include 2 - 3 Arkansas varieties for CRISPR-mediated Chalk5 modification. Tissue culture/regeneration response of these varieties is currently being investigated in our lab.b. CRISPR vector construction: We have obtained the CRISPR vector, pRGEB32 and pRGE32, from Addgene. We will develop Chalk5 targeting vector in pRGEB32 and pRGE32 backbones. Each vector will contain two sgRNAs, one each for RY/G box (-721) and CACT (-485), for multiplexed targeting at the two sites. The proposed sgRNAs are CTATTAAAGTTTATCATCAC and TAGACGGTGCCGTTTGTAG for targeting RY/G and CACT sequences, respectively. Each of these spacer sequence (aka seed sequence) is immediately followed by the protospacer adjacent motif (PAM) sequence NGG. This multiplexed targeting by the sgRNA-Chalk5/Cas9 construct may result in the deletion of ~300 bp region spanning -438 to -738 without disturbing the basal promoter region (335 bp upstream of start codon). As a result, both RY/G box and CACT will be disrupted. The PLACE cis-element analysis of the targeted region (-438 to -738) indicates that some WRKY elements that respond to drought will also be deleted, which may alter promoter activity more dramatically than observed in H94 allele that lacks only RY/G and CACT enhancers. The verification of the vectors will be done on Nipponbare callus by co-bombarding pRGE32-Chalk5 DNA with the selection gene construct (pHPT). The resulting hygromycin-resistant callus lines will be analyzed for the excision of the targeted ~300 bp region by PCR. Detection of the targeted deletion will verify the vector.c. Rice transformation: An efficient protocol for rice transformation through Agrobacterium tumefaciens has been established for the cv. Nipponbare in PI's laboratory.d. Molecular characterization: The hygromycin callus clones resulting from transformation will be analyzed by PCR for the presence of InDels at Chalk5 target site. To determine potential 'off-target' effects of sgRNA/Cas9, the rice genome will be searched for homologies by BLASTN with the two sgRNA seed sequences as query. If the searched homologous sequence is juxtaposed to NGG PAM, we will design PCR primers to amplify the 'off-target' region and sequence the amplicons to determine the presence of InDels at these sites. This data will be important in assessing the propensity of 'off-targeting' by Chalk5 sgRNA, and the effect of the 'off-target' InDels with plant phenotype.e. Selection of edited lines and Chalk5 expression analysis: The 'edited' line, here, refers to the transgenic rice lines showing targeted deletion in Chalk5 locus. These lines will be grouped based on the InDel data into 'small' and 'large' InDel, and at least 3 representatives of these groups will be used for determining Chalk5 expression pattern in the developing seeds. For this, homozygous plants will be identified in T1 generation by PCR for the InDel site (homozygous plants will contain a single ≤0.7 kb band as opposed to two band pattern in heterozygous plants. The seeds of the homozygous plants will be saved for the future phenotypic analysis. The expression data will be correlated with the InDel data, and used for its correlation with grain phenotype in control and HNT conditions in future (as described in section 6b). The selected lines will be grown to collect T2 seeds that segregated from sgRNA/Cas9 construct to generate transgene-free edited lines.f. Plant phenotyping: The selected homozygous lines will be grown in the greenhouse,visually inspected for healthy vegetative and reproductive growth. The grains will be inspected for white belly and the bulked seeds will be saved for analyzing chalkiness (the analysis of amylopectin (long chain B3, milling yield using a laboratory scale mill) in response to high nighttime temperature.

PROGRESS: 2018/05 TO 2019/05
Target Audience:Rice breeders and growers in Arkansas and US. Changes/Problems: Nothing Reported What opportunities for training and professional development has the project provided?This project supported one graduate student from the University of Arkansas at Pine Bluff (UAPB). The student was trained in CRISPR editing of Chalk5 gene in rice. This project helped student understand the process of developing T0 and T1 plants in rice. How have the results been disseminated to communities of interest?Maharjan B, SK Ponniah, and M. Manoharan. CRISPR/Cas9 Mediated Editing of CHALK5 Gene in Rice (Oryza sativa L. spp. japonica cv. Nipponbare) - 63rd Annual Rural Life Conference, Pine Bluff, AR-February 1, 2019. B. Maharajan (2019): CRISPR/Cas9 Mediated Editing of CHALK5 Gene in Rice (Oryza sativa L. spp. japonica cv. Nipponbare). UAPB Annual faculty and student research forum, University of Arkansas at Pine Bluff, and April 3-4, 2019. What do you plan to do during the next reporting period to accomplish the goals?We will determine the role of Chalk5 in temperature-induced chalk formation in plants grown during elevated night- time temperature.

IMPACT: 2018/05 TO 2019/05
What was accomplished under these goals? The T0 plants were developed through Agrobacterium-mediated transformation. Total of 27 independent events from two guide RNA (gRNAs) and 29 independent events from three gRNAs were confirmed using Cas9, gene-specific, and hygromycin primers. The progeny analysis was performed in T1 seeds using the selfed seeds collected from T0 plants. The plants which lacked Cas9 gene sequences were confirmed using Sanger sequencing. Five plantsfrom two gRNAs and four plantsfrom three gRNAsthat were free from Cas9 gene sequences were characterized for the gene expression analysis using quantitative Real-time PCR (qRT-PCR). The seeds from Cas9 free T1 plants were analyzed for the chalkiness trait using WinSeedle Pro 2019a (Reagent Instruments Inc., Sainte-Foy, Quebec, Canada) image analysis system.

PUBLICATIONS (not previously reported): 2018/05 TO 2019/05
Type: Conference Papers and Presentations Status: Published Year Published: 2019 Citation: Maharjan B, SK Ponniah, and M. Manoharan. CRISPR/Cas9 Mediated Editing of CHALK5 Gene in Rice (Oryza sativa L. spp. japonica cv. Nipponbare) â Plant and Animal Genome Conference, San Diego, CA-January 12-16, 2019.